Apple Store is down...new iMacs/Mac Minis?
Posted by: John Rougeux
Apple Store is down...new iMacs/Mac Minis? - 03/03/09 05:15 AM
As of 815am e.s.t., the Apple Store is down. Rumors of new iMacs and Mac Mini computers.
Posted by: John Rougeux
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 05:25 AM
Appleinsider has this as what's coming out today:
iMac's
MB417LL/A - IMAC 20" 2.66/2GB/320GB/SD/MSE/KB-USA
MB418LL/A - IMAC 24" 2.66/4GB/640/SD/MSE/KB-USA
MB419LL/A - IMAC 24" 2.93/4GB/640/256/SD/MSE/KB-USA
MB420LL/A - IMAC 24" 3.06/4GB/1TB/512/SD/MSE/KB-USA
Mac Mini's
MB463LL/A - MAC MINI 2.0/1X1G/120/SD/AP/BT-USA
MB464LL/A - MAC MINI 2.0/2X1G/320/SD/AP/BT-USA
Mac Pro's
MB535LL/A - MAC PRO 2.26_8CX/6X1G/640/GT120/SD-USA
MB871LLA - MAC PRO 2.66QCX/3X1GB/640/GT120/SD-USA
AIRPORT EXTREME:
MB763LL/A - AIRPORT EXTREME - USA
TIME CAPSULE:
MB764LL/A - TIME CAPSULE 500GB - USA
MB765LL/A - TIME CAPSULE 1TB - USA
FIBRE CARDS:
MB842LL/A - DUAL-CHANNEL 4GB FIBRE CHANNEL CARD-GEN
MB843LL/A - QUAD CHANNEL 4GB FIBRE CHANNEL CARD -GEN
RAID CARD:
MB845Z/A - MAC PRO RAID CARD -INT
APPLE KEYBOARD:
MB869LL/A - APPLE KEYBOARD -USA
RAM:
MB976LL/A - 1GB 1066MHZ DDR3 -1X1GB SO-DIMM-GEN
MB980LL/A- 1GB 1066MHZ DDR3 ECC 1X1GB - GEN
MB981LL/A - 2GB 1066MHZ DDR3 ECC 1X2GB -GEN
MB982LL/A - 4GB 1066MHZ DDR3 ECC 1X4GB - GEN
HARD DRIVES:
MB983LL/A - APPLE HARD DRIVE FOR MAC PRO - 640GB
MB984LL/A - APPLE HARD DRIVE FOR MAC PRO - 1TB
AIRPORT EXTREME CARD FOR MAC PRO:
MB988LL/A - AIRPORT EXTREME WI-FI CARD 802.11N
GRAPHICS CARD
MB999LL/A - ATI RADEON HD 4870 512MB
Posted by: John Rougeux
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 05:48 AM
and it's back up with all those new goodies.
Posted by: margadagio
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 06:06 AM
It sucks to be Canadian
Posted by: MacGizmo
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 06:15 AM
Why? You weren't going to buy any of them anyway, Marg! ;-)
Posted by: margadagio
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 07:04 AM
Why? You weren't going to buy any of them anyway, Marg! ;-)
Ya think? I had my eye on a new Mac Pro when my G5 dies. Given it's age that could be anytime.
Here's the problem. It's true I wasn't thinking of buying until perhaps the new year. If by some miracle the Canuck buck rises, Apple will continue to rape the Canadian customer until the next Pro update. That could be a while.
Next problem. My daughter could use a new Mini in the near future. Again we're screwed. No new Mini until the NEXT refresh and heavens knows when that will be.
I hate paying a 20 - 30% premium and won't do so unless I've no choice. I can tell you these price increases won't bode well for Mac sales in Canada, specially in a recession.
Posted by: John Rougeux
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 07:20 AM
Marge, why a Mac Pro? I thought you are retired? Mac Pro's are generally overkill for the majority of folks except for those who are into video editing (and not iMovie. Talking Final Cut Pro) or other strenuous editing.
The iMac is the one that's awesome. I'm using it with Photoshop CS4 and have 0 problems. It runs fast!
Next problem. My daughter could use a new Mini in the near future. Again we're screwed. No new Mini until the NEXT refresh and heavens knows when that will be.
And I'm not sure how your daughter is screwed because of the unknown date of the next mac mini? When she's ready to update, I would think that whatever out there at the time would be just fine. I just got my iMac in January and I'm more than happy with it even though they just updated it.
Posted by: margadagio
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 07:32 AM
I've thought about it a great deal. The iMac is okay when it's new. Lordy help ya if something goes wrong. I can't swap out my own HD. That means taking it in and waiting 2 weeks to get it back. I like the ability to have more than one internal drive.
To be honest, I'm not all that impressed with the iMac's QC.
As for the Mini. The daughter will have to put up with her old, slow Mini. It's a matter of principle. I refuse to pay an extra $200 because I happen to live in Canada. If hers dies she can go get a used Mac somewhere.
Posted by: John Rougeux
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 07:39 AM
I had the same feelings about internal HD's until both Mac Pro's that my Dad and brother got had to be taken into the Apple Store numerous times until Apple finally replaced the motherboard on them.
I now have 1.8TB of external HD space that I can use on any computer.
What hasn't impressed you with the QC of the iMac? I'm really curious because I haven't heard much other than the occasional optical drive going bad.
Posted by: MacBozo
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 08:05 AM
Marg! One word - refurbished. Great deal and they are just as reliable as new.
Posted by: MacBozo
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 08:10 AM
I'm perfectly happy with my refurbed Mini (now previous version as of today). Of course, the new $599 model is basically what I spent $679 for and was the previous $799 model. I'd call that a price reduction and you now get much better graphics performance with support for two monitors and 802.11n wireless. Would have been nice to have been able to wait 4 months, but I'm not complaining. Previous Mini version is now $549 refurbed at the on line Apple Store.
Posted by: polymerase
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 08:46 AM
I knew they would announce the day after I bought a new MacPro. Could someone tell me if there is any great shakes between the 2x2.28 Xeon and the Mehalen processor they just came out with? OK, sure it is the new architecture but is it a huge boost? I am well within the 14 day return window but I really need this box plugged into my backup system. (The new one actually becomes my desktop Mac so I am willing to put up with some hassle.)
Posted by: Jim_
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 08:52 AM
I can tell you these price increases won't bode well for Mac sales in Canada, specially in a recession.
I thought the price range was the same, US $2199 for the top end model, $1199 for the low end.
Posted by: margadagio
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 09:01 AM
Canadian Prices
iMac
$1,399 20"
$1,799 - $2,599 24"
Mini
$729 - $949
Mac Pro
$2,899 , $3,799
I'd love to hear an explanation why AppleCare costs $50 more in Canada. It's a freakin box with a serial number on it. I'd be hitting up an American friend to do a bit of shopping for me. ;-)
Posted by: Jim_
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 09:11 AM
I see I think. The Mini was $649 and $849 if I researched it right?
Posted by: margadagio
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 09:37 AM
Yup, that sounds about right.
The US price is now $599 for the low end. That's a good deal.
I'm an Apple fan so I'll suck it up and pay whatever. Most Canadians will say shove it when the Windows machines are going for about the same price as in the US. We were starting to get quite a few switchers. I can see that slowing down a bit now.
Posted by: Jim_
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 09:41 AM
Yeah, $949 for a Mini is steep considering the US price on a low end iMac is $1199, and you get a machine that is much much faster in all aspects.
Is one allowed to cross the border and bring a US product back, or do they make you pay some tax if you do?
Posted by: margadagio
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 10:29 AM
If you declare it you must pay 13% tax. Whether you buy here or import, the government has their hand out.
Posted by: FSM
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 11:40 AM
I knew they would announce the day after I bought a new MacPro. Could someone tell me if there is any great shakes between the 2x2.28 Xeon and the Mehalen processor they just came out with? OK, sure it is the new architecture but is it a huge boost? I am well within the 14 day return window but I really need this box plugged into my backup system. (The new one actually becomes my desktop Mac so I am willing to put up with some hassle.)
it's it's me, i'd be returning the new one for the newer model, particularly if it's going to be the machine you're using most of the time.
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 01:15 PM
Marg, you might want to take another look at getting an iMac. I'm becoming convinced that the Pro towers are overkill for many of us. Until such time as the apps themselves are coded to fully take advantage of multiple cores and multiple processors, all someone like you or I really gets with a tower is expandability. I for one am not as enthusiastic as I used to be for the tower solution. I'm looking hard at getting the middle or top option Imac and using a couple of external drives for twin backups.
The biggest drain on processing power I use is Logic 8. Everything I've read indicates that a contemporary iMac with 4 gigs of RAM will run Logic just fine. Certainly it will blow the doors of my aging dual G5 tower, which is what really counts. And it comes with a nice display - the towers are clearly aimed at power users. LOL! I just don't think I am one of those. I am a graphics guy who needs to run the Adobe suite and Logic... and maybe Lightroom. A brand new iMac will not shirk at doing any of that.
I'm not ready to upgrade yet in any case and I haven't ruled anything out but for the first time ever I am thinking of buying an iMac. That in and of itself is a big change for me.
Posted by: margadagio
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 01:37 PM
Max, I hear ya. I'd finally set my mind to accepting an iMac but recently did a 180 in my thinking. I know the tower is overkill. I wish Apple had a stand alone tower between the iMac and Mac Pro.
The problem is mostly with the hard drives. Max, if the iMac drive fails it isn't an easy matter of slapping in a new drive like we're used to. It means taking in to the shop and have someone else do it. You live near Carbon so you might get your machine back in 2 days. For me it means taking my machine into the Sherway or Yorkdale Apple store and waiting 2 weeks. I refuse to pay their extortion fee to get it back quicker.
The hard drives being manufactured these days are cheaply made. There's no such thing as a good one these days. They've all gone to cheap mass production in China. Seagate used to be made under tight tolerances in Singapore but no more. The chances of a drive failure within a couple of years is quite high now. In the iMac it can make things worse. They run very hot which can kill the life span of a hard drive. Some machines get so hot you can almost cook eggs on them. Others are okay. It's the luck of the draw.
Max, it's going to cost a few bucks more for a tower but considering your need for something reliable on the job, I'd be mulling it over some more.
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 01:54 PM
OK, understand your reasoning, Marg. However, I disagree that all hard drives are junky these days, or that their Chinese origin is the reason that they're failing. I haven't noticed any greater failure rate in my drives these last few years. I generally look for whatever the consensus of the day is and go with that choice - it's served me well thus far. Usually I'll ask in a place like this, and I'll also query Alec, as he often knows more about this sort of thing from his experiences in the field. He hasn't steered me wrong yet. But I can't afford the Drobo option, however nifty it seems!
I wouldn't mind paying the considerable premium for the tower lineup if I were convinced that the main software I use could actually effectively harness all that theoretical extra processing muscle; I am not. So in the end, a tower is a bigger, clunkier route, offering me some more drive bays but little else. I don't need it to be stuffed with RAM - I imagine 4 to 6 Gb should do me fine for the next few years.
I do see your point about what happens should your iMac drive fail, however. That sucks. And I, like you, can't afford downtime. Especially once I'm at work. No way.
Posted by: margadagio
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 02:11 PM
Unless this new iMac is different, Apple isn't making it easy for user repairs.
As far as hard drives? I've had more drives fail in the last 2 years than ever. I'm not alone. Both Swatty and carp had drive failures within 9 months of their iMac purchase.
There is a reason why drives are inexpensive. They just roll off the assembly line and boxed for export. No QC. Even Seagate aren't what they used to be. They bought Maxtor and what you have now is a Maxtor with a Seagate label slapped on it. If you get a good drive these days it's more to do with luck. I'm not impressed. I'd rather pay more up front for quality I can depend on. Obviously the masses would rather go cheap.
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/03/09 03:01 PM
I dunno. I mean, anecdotal is anecdotal, y'know. Sorry about Swatty and Carp's hard drive misadventures but it ain't enough to convince me.
I dig you want to pay up front for quality you can depend on. But what's that mean, in an era when everything is made in the Pacific Rim anyway? What's Apple using for components other than fairly mainstream stuff?
Posted by: MacGizmo
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 05:07 AM
Marg:
You're kind of dreaming here. The drives in the iMac are the same drives as you find in the MacPros. They're made by the same people, they're just different dimensions to fit in the case. So this really isn't a quality thing, it's more of a convenience thing (not having to take the computer in to have a new drive put in should it go bad).
Sorry to hear you're having such bad luck with HDs failing. I've only had one drive fail in all my Mac-using years (it was a Panasonic drive, by either Western Digital or Phantom).
Max
I tend to agree with you about the Pro vs. iMac debate. While I have a MacPro now, I still find myself wondering if I should have just gone with the 24" iMac. Ultimately, I went with the pro for the Xeon processors. I only have 3GB of RAM anyway, and have only added 1 internal HD which I got because it was so cheap.
I keep telling myself I like the "expandability" of the tower, but in reality I rarely add anything anyway. 4GB of RAM is plenty for anyone but the most demanding user, external drives have the flexibility of being able to take them anywhere, and the 24" screen on the iMac is beautiful - plus you get the iSight built-in.
Posted by: margadagio
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 05:09 AM
Max, this is my point. I have nothing against the iMac per se. Like I mentioned, I was all for it until I realized the downside... lack of ability to swap a simple hard drive.
While not everyone will encounter problems the odds are significantly higher these days of having a hard drive failure in a shorter time frame.
Apple gets their components from the same place everyone else does. Unfortunately all the manufacturers have lowered their standards in order to compete on price. Of course they all have warranties so you can get a refurbished replacement. That's not really the point for me. With my G5 I can swap out a drive in a minute. An iMac means taking it in to a service repair shop and waiting who knows how long to get it back. Don't believe me? Check with our mutual friend.
Max, I'm just trying to be helpful and point out some pitfalls of the iMac. I think I have some handle on the nature of your job and your need for reliability. I just don't want you to be in a major suckage on the job when you're in the middle of a production schedule. The odds of it happening with an iMac are up a bit from our G5 work horses. Like I mentioned previously, I wish there was a machine between the iMac consumer line and the overkill Mac Pro. Luckily you live near Carbon. Those folks understand the industry so you're likely to get better turn around service than dealing with Apple retail. Only you know what you can live with so weigh the pros and cons for yourself. As far as ability, the iMac is one great machine.
Like always, just my 2 cents. ;-)
Posted by: margadagio
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 05:14 AM
Marg:
So this really isn't a quality thing, it's more of a convenience thing (not having to take the computer in to have a new drive put in should it go bad).
THAT's my whole point.
Of course the HD's are the same quality no matter what machine you buy.
Posted by: MacBozo
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 06:35 AM
It isn't impossible to change the HD in an iMac yourself. Just more involved than a tower. Changing the HD in a Mini isn't a piece of cake, either but it is doable - done it myself. Maybe the Mini shold have been a small tower? Apple doesn't embrace the mundane.
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 07:29 AM
Marg, it's all good and I appreciate what you're trying to say. But if I was at work and my iMac failed, I'd already be backed up and I would rent a replacement machine straight away - or, more likely, I would bring in my home tower and make it be the beast of burden until my sad iMac became happy again. I can afford half a day of down time, a day at most. That's the way it is. And if MacBozo is right, then perhaps I could switch out my own failed hard drive and not bother with taking the machine in for servicing. I am willing to take the risk.
Gizmo: I am glad to hear from you, as I suspect the kinds of stuff we do as designers tends to overlap a great deal. I am convinced that the Adobe suite as currently coded on the Mac side is not up to the power the towers represent. Work-wise, the Adobe suite represents 90% of what I do at work. Plus, I, like you, have rarely added anything other than the occasional drive to my towers - once in a while I've added something like a card for extra USB ports, but that's about it. I am over towers. It occurs to me, all these years later, that I really didn't require what they offered... and I paid a fairly stiff price in order to pat myself on the back and consider myself a power user!
I really think that, when it's time, I'm going to go with an iMac. I'll get 4 Gb and will also attach my 20" Apple display and that should be quite decent performance specs for the stuff I do.
Posted by: MacBozo
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 08:29 AM
Well, going into the newer iMacs to change the HD requires the removal of the display glass, etc. It is time consuming, but doable if you're very careful and not in a hurry.
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 10:11 AM
Gotcha... sounds finicky to me. I likely won't be servicing my own iMac then.
Posted by: Swatcat
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 12:18 PM
Max even with my hard drive misadventure I have no regrets about my iMac,as a matter of fact I purchased another 24 inch iMac for my son.
I have Apple Care on both machines when Apple Care runs out I would not hesitate installing a hard drive.
Marg needs to Think Different about macs and understand that a mac does not have to be the size of a refrigerator

Go with the iMac Max.
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 01:22 PM
Swatty, most excellent to hear from you. Thanks for your viewpoint. No one is right or wrong in this thread... it's just good to get some varied opinions.
Good point about doing your own installations... [i]after[i] Applecare is toast. LOL!
Thanks again, man.
Posted by: polymerase
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 02:49 PM
Since I now have three towers warming my legs in my office right now and one will be swapped for a Nehalem I can throw in my two cents.
I would never get a tower for home. The iMacs are plenty powerful enough and sawtty is right, a computer does not have to be as big as a fridge . Also doesn't have to consume the same electricity either. These suckers eat the kwatts.
Posted by: margadagio
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 02:51 PM
heh heh, okay, I'm out gunned.

Max, I forgot about the possibility of renting a machine. In that case my caution is perhaps not valid in your case. The iMac is certainly up to the job.
I still haven't changed my mind, swatty. I like refrigerators.
Posted by: MacBozo
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 03:05 PM
I thought you had a time lock installed on yours.

How's the diet going?
Posted by: Swatcat
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 03:20 PM
I still haven't changed my mind, swatty. I like refrigerators.

Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 09:16 PM
Thanks, all, for weighing in - you too, Poly.
Cheerio...
Posted by: polymerase
Re: Apple Store is down...new iMacs/Mac Minis? - 03/04/09 11:36 PM
Now that I said I would never get another tower for home I would like to turn a 180 and completely contradict myself. I wouldn't because my computational needs at home are not humongous. I don't do art, graphics, movies, photoshopping type stuff on huge files there.
But maybe I don't because the stuff is too slow. So my contradiction: There is never such a thing as too much computational power. Get it and you will find a way to use it. At work I am dealing with a 2GB file which really isn't but I will describe it as a spread sheet with 20 million lines and each line has a nucleotide sequence:
GATCGTAGCATGCGTACGATGCTG
TTTTTTTTCGGTAGCTAGCTAGCTAGCATCTAG
TTTTTCGCTAGTCGGTCGTGATCGATCGATCGATC
...
And I need to filter lines that have multi GATC in them and poly T runs in them and a few other rules. With 20 million lines this might take more than a few minutes to compute. So the Nehalem chip can be handy. Prior to the Nehalem I might never of considered doing this on a Mac.
Now at home the computational stress comes from gigantic movies, photos, art, which if you could manipulate in seconds instead of minutes you would do it.
So, in the end, I think Marge is right, we all need Nehalem Towers at home once there are programs that can take advantage of it. There never is going to be a time where "this is fast enough" unless all you do with computers is internet surf and view Youtube. Even then speedy is handy.
The iMac at home is for most of us who can wait for the processing speed to trickle down to those kind of boxes but some of us can't wait.
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/05/09 04:43 PM
I'd be all over the towers if I thought Adobe's stuff was actually going to use that muscle. I've not been able to find anything which indicates that their stuff would efficiently harness that (expensive) extra ooomph. Logic would, perhaps, but then again Logic is not my bread and butter - it's my playground for when I'm not pushing pixels and slinging vectors for a living.
The next version of the Suite would probably be able to go there. Meantime, money's tight and I can't afford to be as care-free as I once was.
[suddenly turns away and runs over horizon, sobbing hot tears of bitterness]
Posted by: polymerase
Re: Apple Store is down...new iMacs/Mac Minis? - 03/05/09 05:04 PM
That would be a sober decision if using a commercial package like PhotoShop. They have too many customers and too many lines of code. That adds up to not recompiling their software for a long time until customers had the boxes and they were whining.
My AGTC example is the opposite. I am using a program used by three people and it needs recompiling if you breath on it. But adding the port to 8 processors is the holy grail to long chuggers like this. 2 hours so much better than 4 hours. You make up in processors what you screw up in coding.
I've found that, (and I think I am only taking MacGizmo's advice on this) is that something like Photoshop works just as well on the off the bleeding edge boxes like a nice fast iMac. Those boxe are about a year behind the curve and the iMac is about two years behind the curve so good match.
I guess I am contradicting myself a second time. or is that three?
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/06/09 06:26 PM
Hey, doesn't matter. I'm entertained nonetheless. Helps me spend less doughski, too. Believe me, that's all good.
Posted by: DLC
Re: Apple Store is down...new iMacs/Mac Minis? - 03/07/09 05:19 PM
Yeah I'm having the SAME thoughts Varmit ... I'd really jump if the iMacs had
quad core and I think that will happen in the next 12 months – after Snow Leopard arrives. Probably overkill, but one would have plenty of room for growth and make that puppy last 6-7 years.

Max-imize your Mac !!
Posted by: Mississauga
Re: Apple Store is down...new iMacs/Mac Minis? - 03/08/09 06:46 AM
... the towers are clearly aimed at power users. LOL! I just don't think I am one of those.
Au contraire, mon frère! I place you directly in the category of power users.
In my humble opinion, and from the track record of numerous clients running new(er) iMacs, the Intel iMac has indeed dramatically narrowed the gap between consumer and professional product. The obviously overwhelming drawback to the iMac is expandability. Other than adding RAM, nothing is "user friendly" and to a power user, the lack of sufficient I/O ports can be a deal breaker. Having to resort to a USB hub generally proves problematic for many, including myself - and I also yearn for additional FW400/FW800 ports.
After careful study of the take apart manual, I wouldn't touch internal servicing "with a ten foot pole"! Those who take the risk of accessing the internals run a strong risk of voiding their warranty, as Apple can now quite easily detect user tampering. And if one needs to rely on an Apple Store for take apart service, the queue can be as long as a week or more. Even the Store techs don't like taking them apart.
In regards to the performance differential between the iMac and Mac Pro, there's more to the equation than just the processors; bus speed and cache sizes play an important role in almost all processes, not to forget the fact the Mac Pro allows far greater RAM expandability well beyond 4 GB and one should carefully consider these facts if any consideration is given to longevity and ability to "squeeze out" every bit of horsepower during a busy day.
Nearly a month ago, I upgraded a clients rev.a Mac Pro from 4 GB to 8 GB RAM and added a second hard drive as a dedicated scratch disk for Photoshop. This user traditionally leaves all her apps running through the day and had been noticing a certain amount of sluggishness with overall performance. She does work with large and numerous Photoshop and Illustrator files, creates print documents with InDesign, leaves the entire Office suite running and uses Windows XP in Parallels on a regular basis. The occasional weekly restart did clear out some cache files, but no discernible performance improvement was gained. Her Mac Pro now "feels like a new machine", as she claims - high praise coming from one of my more demanding clients. At a cost of under $300, the upgrades were well worth the "small" investment - NOT attainable with an iMac!
Think long and hard before making your decision, Max. I wouldn't let a friend make such an important choice without providing all I can to assist.
Cheers!
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/08/09 02:57 PM
Alec, thoughtful post and I thank you for it. I'll have to do just that... think long and hard about the choices I'll be facing. Didn't know that about the USB hubs, either. That could be an issue for me, as when I'm at work I'm jacked into two printers, a scanner, a Wacom tablet and an external drive that's USB-connected. Hmmmm...
Thanks again, dude!
I was really looking forward to the iMac display and the iSight, too... dang. Maybe I'll have to spring for a new display. Decisions, decisions...
Posted by: Jim_
Re: Apple Store is down...new iMacs/Mac Minis? - 03/08/09 03:15 PM
I go with Alec on the USB hubs, any model of hub, I've seen problems with many brands. What works on one may not work on another. They don't do well under some conditions depending on what's plugged in or what it's plugged into. I have had my own personal problems so I got a PCI card.
Posted by: Mississauga
Re: Apple Store is down...new iMacs/Mac Minis? - 03/08/09 03:18 PM
My experiences with my current hub include one or more devices suddenly non-operational until a restart - happens too frequently for my "meager" needs at home. My next purchase will undoubtedly be a tower - still miss my old MDD for its expansion capabilities.
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/08/09 04:17 PM
Hmmmm.... come to think of it, the most stable USB situation I'd had was on a dual G4 with a PCI card with USB 2... hubs are always a bit iffy, but it sounds like these days it's even more so. Kind of disappointing. I thought USB was supposed to be a stable standard when it first came out. Guess not!
Posted by: John Rougeux
Re: Apple Store is down...new iMacs/Mac Minis? - 03/08/09 05:11 PM
I have been using the Belkin 4 port hub with no problems.

I have my iPod, Printer and external HD's plugged into it.
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/08/09 05:37 PM
Nice design. I have this old Belkin that looks like a freakin' purple toilet seat. So many hubs with bad design out there.
Well, glad it works for you, John. I still think I'd spring for another card if I ran out of ports... oh, and I forgot - I need another port for my Logitech wireless mouse unit. And there's also the Sandisk card reader that I use pretty much every day... hoo boy.
Posted by: carp
Re: Apple Store is down...new iMacs/Mac Minis? - 03/08/09 05:59 PM
Me too I never had a USB problem with my 4 port Belkin either . I had the printer , camera and scanner plug to it .
Well except one time when my joker of a daughter plugged the Belkin into itself via the 4th open port

took me a bit of time to figure that one out
Posted by: Jim_
Re: Apple Store is down...new iMacs/Mac Minis? - 03/08/09 06:16 PM
If you're talking about the clear Belkins that one in particular has been a head scratcher more than once, but I can also tell you most times it worked fine. One worked on my machine, but took it to an older iMac and it couldn't boot if the hub was plugged in, but it didn't do it on another iMac of the same kind. Replacement hub did the same, sometimes these things work, sometimes they don't is all I'm saying, but I've seen what I consider an inordinate amount of problems with hubs as compared to PCI card solutions, which are 0 in my recollection.
Posted by: carp
Re: Apple Store is down...new iMacs/Mac Minis? - 03/08/09 06:52 PM
It was the round hockey puck one , black with a red on light , small and stackable - Plugged into the 1st gen Mini and later the 2nd gen Mini <-- no problems
Certainly - nothing beats a PCI Card solution but to a Mini would mean an extreme make over to get a card inside

Conversely I had a problem with Apple Keyboard USB ports with the printer , that one was plug direct to the Mini - which had only 2 USB ports 1 keyboard and 1 free = ya need to have a hub if you have a scanner , camera and other slick
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/08/09 07:10 PM
Yep... you sure do.
Hmmm... this feels like a ping-pong game to me... iMac, tower, iMac, tower... LOL
Posted by: Mississauga
Re: Apple Store is down...new iMacs/Mac Minis? - 03/09/09 06:48 AM
I forgot to ask if this machine will be for your business or home studio? If for the business studio, is there a budget? While there's only one Mac Pro there now, Apple's refurbs might be a way to go.
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/09/09 10:55 AM
Business primarily. Comes with me to work when we begin the shooting season, comes back home with me once the season is wrapped. I charge them weekly for rent of the equipment as part of the contract. As for budget, I dunno. That's a tough one to answer. Depends partially on how busy the season looks to be - how many episodes we're shooting, whether or not we're doing two series rather than just one... if it's a lot of episodes and we're doing two series, then I can spring for more. Problem is we also want to replace Mila's aged single G5 tower with a 24" iMac. Amounts to a lot of money in uncertain times, you know?
Haven't thought of the refurb route but that's a useful option, thanks. I won't be doing anything until work details have been hammered out and I can see a preliminary work schedule.
Posted by: MacGizmo
Re: Apple Store is down...new iMacs/Mac Minis? - 03/09/09 05:17 PM
Max, regarding the Adobe "coding" to take advantage of the MacPro processors:
In there current state (Creative Suite 4), they aren't taking full advantage. We're just hosed. BUT, they ARE working on it for the next version. That's about all I can say on the topic. Part of it is OSX itself, and part Adobe just trying to keep a balance between adding new features and keeping the speed acceptable.
You are in a field that I admittedly don't fully have a grasp of (technically speaking). Video work uses every bit of juice you can throw at it, I know that much. I can't say for certain that you wouldn't regret not having a MacPro vs. an iMac - you would know better than I would... However, these iMacs are no slouch, and with the RAM limit bumped up even more, the gap between the need for an iMac vs. a Pro is getting wider - I mean you really gotta KNOW you're going to need every last ounce of power from the Pro to justify the cost increase, and the lack of the 24" screen and iSight.
For me, I'm heavily betting that the next Mac I buy (whenever that is) will be an iMac. For print & web design, you simply do not need anything more. That wasn't the case just a few years ago, but it certainly is now.
Posted by: VarmintBlubber
Re: Apple Store is down...new iMacs/Mac Minis? - 03/09/09 07:17 PM
Thanks for the feedback, Gizmo... but I don't do video - maybe, in my personal time, a bit of amateur-stuff from time to time with Quicktime slide shows, but for my purposes as a television art department grunt, it's strictly 2D stuff - Indesign, Illustrator, Photoshop, iPhoto (maybe, in the near future, Lightroom)... none of that stuff, to my knowledge, will take full advantage of the crazy horsepower the towers offer... yet.
This is turning out to be a very difficult issue for me, personally... I want lots of USB ports, but I don't need all the extra hard drive bays. I want the speed but the apps I use aren't geared to really take advantage of the speed gains a tower offers. I want the best bang for the buck but at this juncture it's a bit of an open question! Talk about your rocks and hard spots.
Posted by: giftshoppe
Re: Apple Store is down...new iMacs/Mac Minis? - 03/11/09 01:36 AM
Maybe its just new for the mean time but by the time it will used it can make easily damage.that's why better to buy a little bit much expensive so that it would take longer to be used.
_____________________________
Look for the
groomsman gifts.
Posted by: starmillway
Re: Apple Store is down...new iMacs/Mac Minis? - 03/11/09 12:09 PM
I use both a PC [MS Windows 98] and Macintosh.
Which do you use?
If both, which computer is your favorite?
Posted by: MacBozo
Re: Apple Store is down...new iMacs/Mac Minis? - 03/11/09 12:15 PM
Talking to bots now?
Posted by: starmillway
Re: Apple Store is down...new iMacs/Mac Minis? - 03/11/09 12:56 PM
Gave it a chance to be 'active' before I 'zap' it!

That, and, I lied about using a PC with Win 98 -- sorry 'bout that . . .
Posted by: Jim_
Re: Apple Store is down...new iMacs/Mac Minis? - 03/11/09 01:48 PM
Talking to bots now?
Not a bot, but a spammer maybe. The link in the poster's sig is leading to his website, but others do that here to.
Posted by: yoyo52
Re: Apple Store is down...new iMacs/Mac Minis? - 03/11/09 03:23 PM
Talking to bots now?
Not a bot, but a spammer maybe. The link in the poster's sig is leading to his website, but others do that here to.
As in your sig?
Posted by: Jim_
Re: Apple Store is down...new iMacs/Mac Minis? - 03/11/09 06:09 PM
Hmm, now that you mention it, I guess that isn't fair, you know, all the money those links make me and all.
Posted by: yoyo52
Re: Apple Store is down...new iMacs/Mac Minis? - 03/11/09 07:50 PM
Hey, I'm waiting for last month's report man . . . get on it!