• AppleCentral Network:
  • Tech Support
  • |
  • Open Source
  • |
  • Apple News
  • |
  • Register Domains
  • |
  • SSL Certificates
  • |
  • iPod Deals
  • |
  • Mac Deals
  • |
  • Mac Book Shelf
  • AppleCentral Home
  • MacTech Magazine
    • About MacTech in Print
    • Issue Table of Contents
    • Subscribe
    • Risk Free Sample
    • Back Issues
    • MacTech DVD
    • MacTech Archives
    • MacTech Print Archives
    • MacMod
    • MacTutor
    • FrameWorks
    • develop
  • MacNews.com
    • MacNews News
    • Blog
    • MacTech Reviews and KoolTools
    • Whitepapers, Screencasts, Videos and Books
    • News Scanner
    • Rumors Scanner
    • Documentation Scanner
  • Apple Expo
    • by Category
    • by Company
    • by Product
  • MacForge.net
  • Job Board
  • Advertising
    • Benefits of MacTech
    • Mechanicals and Submission
    • Dates and Deadlines
    • Submit Apple Expo Entry
  • User
    • Register for Ongoing Raffles
    • Register new user
    • Edit User Settings
    • Logout
  • Contact
    • Customer Service
    • Webmaster Feedback
    • Submit News or PR
    • Suggest an article
  • Connect Tools
    • MacTech Live Podcast
    • RSS Feeds
    • Twitter
You are not logged in. [Log In] AppleCentral » Forums » Publications, Articles and Industry Discussion » Apple World » Apple Store is down...new iMacs/Mac Minis?
Register User    Forum List        Active Topics    FAQ
Page 4 of 7 < 1 2 3 4 5 6 7 >
Topic Options
Hop to:
#417450 - 03/04/09 06:11 PM Re: Apple Store is down...new iMacs/Mac Minis? [Re: MacBozo]
VarmintBlubber Offline
Disgruntled Gruntleman

Registered: 02/01/08
Posts: 1243
Loc: YYZ
Gotcha... sounds finicky to me. I likely won't be servicing my own iMac then.
_________________________
Max

Top
#417479 - 03/04/09 08:18 PM Re: Apple Store is down...new iMacs/Mac Minis? [Re: VarmintBlubber]
Swatcat Offline
Merry Christmas

Registered: 04/19/02
Posts: 1861
Loc: In Your Servers
Max even with my hard drive misadventure I have no regrets about my iMac,as a matter of fact I purchased another 24 inch iMac for my son.
I have Apple Care on both machines when Apple Care runs out I would not hesitate installing a hard drive.
Marg needs to Think Different about macs and understand that a mac does not have to be the size of a refrigerator wink
Go with the iMac Max.

Top
#417494 - 03/04/09 09:22 PM Re: Apple Store is down...new iMacs/Mac Minis? [Re: Swatcat]
VarmintBlubber Offline
Disgruntled Gruntleman

Registered: 02/01/08
Posts: 1243
Loc: YYZ
Swatty, most excellent to hear from you. Thanks for your viewpoint. No one is right or wrong in this thread... it's just good to get some varied opinions.

Good point about doing your own installations... [i]after[i] Applecare is toast. LOL!

Thanks again, man.
_________________________
Max

Top
#417510 - 03/04/09 10:49 PM Re: Apple Store is down...new iMacs/Mac Minis? [Re: VarmintBlubber]
polymerase Offline


Registered: 04/19/02
Posts: 11640
Since I now have three towers warming my legs in my office right now and one will be swapped for a Nehalem I can throw in my two cents.

I would never get a tower for home. The iMacs are plenty powerful enough and sawtty is right, a computer does not have to be as big as a fridge . Also doesn't have to consume the same electricity either. These suckers eat the kwatts.

Top
#417511 - 03/04/09 10:51 PM Re: Apple Store is down...new iMacs/Mac Minis? [Re: VarmintBlubber]
margadagio Offline
Princess

Registered: 04/19/02
Posts: 5942
Loc: Toronto
heh heh, okay, I'm out gunned. laugh

Max, I forgot about the possibility of renting a machine. In that case my caution is perhaps not valid in your case. The iMac is certainly up to the job.

I still haven't changed my mind, swatty. I like refrigerators.

Top
#417516 - 03/04/09 11:05 PM Re: Apple Store is down...new iMacs/Mac Minis? [Re: margadagio]
MacBozo Offline
Nut Dood

Registered: 04/21/02
Posts: 17704
Loc: Pinellas Park, Florida
Originally Posted By: margadagio
I like refrigerators.
I thought you had a time lock installed on yours. wink

How's the diet going?
_________________________

Top
#417522 - 03/04/09 11:20 PM Re: Apple Store is down...new iMacs/Mac Minis? [Re: margadagio]
Swatcat Offline
Merry Christmas

Registered: 04/19/02
Posts: 1861
Loc: In Your Servers
I still haven't changed my mind, swatty. I like refrigerators.
laugh



Edited by Swatcat (03/04/09 11:21 PM)

Top
#417586 - 03/05/09 05:16 AM Re: Apple Store is down...new iMacs/Mac Minis? [Re: Swatcat]
VarmintBlubber Offline
Disgruntled Gruntleman

Registered: 02/01/08
Posts: 1243
Loc: YYZ
Thanks, all, for weighing in - you too, Poly.

Cheerio...
_________________________
Max

Top
#417593 - 03/05/09 07:36 AM Re: Apple Store is down...new iMacs/Mac Minis? [Re: margadagio]
polymerase Offline


Registered: 04/19/02
Posts: 11640
Now that I said I would never get another tower for home I would like to turn a 180 and completely contradict myself. I wouldn't because my computational needs at home are not humongous. I don't do art, graphics, movies, photoshopping type stuff on huge files there.

But maybe I don't because the stuff is too slow. So my contradiction: There is never such a thing as too much computational power. Get it and you will find a way to use it. At work I am dealing with a 2GB file which really isn't but I will describe it as a spread sheet with 20 million lines and each line has a nucleotide sequence:

GATCGTAGCATGCGTACGATGCTG
TTTTTTTTCGGTAGCTAGCTAGCTAGCATCTAG
TTTTTCGCTAGTCGGTCGTGATCGATCGATCGATC
...

And I need to filter lines that have multi GATC in them and poly T runs in them and a few other rules. With 20 million lines this might take more than a few minutes to compute. So the Nehalem chip can be handy. Prior to the Nehalem I might never of considered doing this on a Mac.
Now at home the computational stress comes from gigantic movies, photos, art, which if you could manipulate in seconds instead of minutes you would do it.

So, in the end, I think Marge is right, we all need Nehalem Towers at home once there are programs that can take advantage of it. There never is going to be a time where "this is fast enough" unless all you do with computers is internet surf and view Youtube. Even then speedy is handy.

The iMac at home is for most of us who can wait for the processing speed to trickle down to those kind of boxes but some of us can't wait.

Top
#417713 - 03/06/09 12:43 AM Re: Apple Store is down...new iMacs/Mac Minis? [Re: polymerase]
VarmintBlubber Offline
Disgruntled Gruntleman

Registered: 02/01/08
Posts: 1243
Loc: YYZ
I'd be all over the towers if I thought Adobe's stuff was actually going to use that muscle. I've not been able to find anything which indicates that their stuff would efficiently harness that (expensive) extra ooomph. Logic would, perhaps, but then again Logic is not my bread and butter - it's my playground for when I'm not pushing pixels and slinging vectors for a living.

The next version of the Suite would probably be able to go there. Meantime, money's tight and I can't afford to be as care-free as I once was.

[suddenly turns away and runs over horizon, sobbing hot tears of bitterness]
_________________________
Max

Top
Page 4 of 7 < 1 2 3 4 5 6 7 >
Previous Topic
View All Topics Index
Next Topic

Tweet

Preview

Moderator:  Acumowchek, MacGizmo, Reboot 
Print Topic
Switch to Threaded Mode
Publications, Articles and Industry Discussion
   »MacTech/MacNews Article Discussions
   »Apple World
Marketplace
   »Deals and Special Offers
      »Expired Offers
   »Trading Warehouse
Mac
   »Hardware
   »Software
   »Servers, Security, and Networking
   »Programming, Web Dev & Scripting
   »Windows and Virtualization
   »Cloud and Online Services
Mobile Technologies
   »iPhone Apps, AppStore, and iTunes
   »iPad, iPhone, iPod and Apple TV Hardware
Mods and Hacks
   »General Mods
      »Techniques
      »Miscellaneous
      »Mod Logs
   »Laptop Mods
      »Case Mods
      »Hardware Mods
      »Misc. Mods
   »Desktop Mods
      »Case Mods
      »Hardware Mods
      »Misc. Mods
   »Peripheral Mods
      »iPod Mods
      »Misc Mods
   »Software Hacks & Mods
General Discussion
   »Site Feedback & Issues
   »Stan's Lounge
   »Soapbox
Now Software Support
   »Announcements
   »Now X
      »FAQs
      »Discussion
   »Now Up-to-Date & Contact
      »Community Help
      »Tips and tricks
View profile
Send a PM
View homepage
Add to your Watched Users
View posts
View profile
Send a PM
Add to your Watched Users
View posts
View profile
Send a PM
View homepage
Add to your Watched Users
View posts
View profile
Send a PM
Add to your Watched Users
View posts
View profile
Send a PM
Add to your Watched Users
View posts
View profile
Send a PM
Add to your Watched Users
View posts
View profile
Send a PM
Add to your Watched Users
View posts
View profile
Send a PM
View homepage
Add to your Watched Users
View posts
View profile
Send a PM
Add to your Watched Users
View posts
View profile
Send a PM
View homepage
Add to your Watched Users
View posts
Board Rules · Mark all read
Contact Us · AppleCentral · Top

MacTech Only Search:
Community Search:

 
 
 

 
 
 
 
 
  • SPREAD THE WORD:
  • Slashdot
  • Digg
  • Del.icio.us
  • Reddit
  • Newsvine
  • Generate a short URL for this page:



AppleCentral. www.applecentral.com
Main office: 805-494-9797
Xplain's use of MacNews, AppleCentral and AppleExpo are not affiliated with Apple, Inc. MacTech is a registered trademark of Xplain Corporation. AppleCentral, MacNews, Xplain, "The journal of Apple technology", Apple Expo, Explain It, MacDev, MacDev-1, THINK Reference, NetProfessional, MacTech Central, MacTech Domains, MacForge, and the MacTutorMan are trademarks or service marks of Xplain Corp. Sprocket is a registered trademark of eSprocket Corp. Other trademarks and copyrights appearing in this printing or software remain the property of their respective holders.
All contents are Copyright 1984-2010 by Xplain Corporation. All rights reserved. Theme designed by Icreon.
Generated in 0.045 seconds in which 0.032 seconds were spent on a total of 14 queries. Zlib compression enabled.
Powered by UBB.threads™ PHP Forum Software 7.5.8