Gotcha... sounds finicky to me. I likely won't be servicing my own iMac then.

Max even with my hard drive misadventure I have no regrets about my iMac,as a matter of fact I purchased another 24 inch iMac for my son.
I have Apple Care on both machines when Apple Care runs out I would not hesitate installing a hard drive.
Marg needs to Think Different about macs and understand that a mac does not have to be the size of a refrigerator
Go with the iMac Max.

Swatty, most excellent to hear from you. Thanks for your viewpoint. No one is right or wrong in this thread... it's just good to get some varied opinions.

Good point about doing your own installations... [i]after[i] Applecare is toast. LOL!

Thanks again, man.

Since I now have three towers warming my legs in my office right now and one will be swapped for a Nehalem I can throw in my two cents.

I would never get a tower for home. The iMacs are plenty powerful enough and sawtty is right, a computer does not have to be as big as a fridge . Also doesn't have to consume the same electricity either. These suckers eat the kwatts.

heh heh, okay, I'm out gunned.

Max, I forgot about the possibility of renting a machine. In that case my caution is perhaps not valid in your case. The iMac is certainly up to the job.

I still haven't changed my mind, swatty. I like refrigerators.

I thought you had a time lock installed on yours.

How's the diet going?

I still haven't changed my mind, swatty. I like refrigerators.

Thanks, all, for weighing in - you too, Poly.

Cheerio...

Now that I said I would never get another tower for home I would like to turn a 180 and completely contradict myself. I wouldn't because my computational needs at home are not humongous. I don't do art, graphics, movies, photoshopping type stuff on huge files there.

But maybe I don't because the stuff is too slow. So my contradiction: There is never such a thing as too much computational power. Get it and you will find a way to use it. At work I am dealing with a 2GB file which really isn't but I will describe it as a spread sheet with 20 million lines and each line has a nucleotide sequence:

GATCGTAGCATGCGTACGATGCTG
TTTTTTTTCGGTAGCTAGCTAGCTAGCATCTAG
TTTTTCGCTAGTCGGTCGTGATCGATCGATCGATC
...

And I need to filter lines that have multi GATC in them and poly T runs in them and a few other rules. With 20 million lines this might take more than a few minutes to compute. So the Nehalem chip can be handy. Prior to the Nehalem I might never of considered doing this on a Mac.
Now at home the computational stress comes from gigantic movies, photos, art, which if you could manipulate in seconds instead of minutes you would do it.

So, in the end, I think Marge is right, we all need Nehalem Towers at home once there are programs that can take advantage of it. There never is going to be a time where "this is fast enough" unless all you do with computers is internet surf and view Youtube. Even then speedy is handy.

The iMac at home is for most of us who can wait for the processing speed to trickle down to those kind of boxes but some of us can't wait.

I'd be all over the towers if I thought Adobe's stuff was actually going to use that muscle. I've not been able to find anything which indicates that their stuff would efficiently harness that (expensive) extra ooomph. Logic would, perhaps, but then again Logic is not my bread and butter - it's my playground for when I'm not pushing pixels and slinging vectors for a living.

The next version of the Suite would probably be able to go there. Meantime, money's tight and I can't afford to be as care-free as I once was.

[suddenly turns away and runs over horizon, sobbing hot tears of bitterness]